Home
Scholarly Works
Concentration-dependent conformational changes in...
Journal article

Concentration-dependent conformational changes in GQ-forming ODNs

Abstract

Guanine-rich oligodeoxyribonucleotides (ODNs) can form non-canonical DNA structures known as G-quadruplexes, which are four stranded structures stabilized by sodium or potassium cations. The topologies of G-quadruplexes are highly polymorphic. H-Tel, an ODN with four consecutive repeats of the human telomeric sequence, [d(AGGGTTAGGGTTAGGGTTAGGG)], can assume different monomolecular G-quadruplex topologies depending on the type of cation present in solution. Our previous work demonstrated that at high concentrations of H-Tel, the monomolecular G-quadruplexes formed by H-Tel self-associate to form higher order structures. The aggregates display circular dichroism (CD) spectra similar to that of an all-parallel structure. In the current work, we present data for 19 ODNs for which we have modified the loop sequences of H-Tel in order to learn if concentration-dependent self-aggregation is a general phenomenon and to probe the contribution of the loops to the self-association of these ODNs. Our studies use CD spectroscopy and spectroscopically monitored heat denaturation. Our data show that the concentration-dependent formation of parallel G-quadruplex aggregates is a general phenomenon. We propose that one of the factors that might affect this process is the association of partially unfolded antiparallel structures.

Authors

Li YY; Abu-Ghazalah R; Zamiri B; Macgregor RB

Journal

Biophysical Chemistry, Vol. 211, , pp. 70–75

Publisher

Elsevier

Publication Date

April 1, 2016

DOI

10.1016/j.bpc.2016.02.002

ISSN

0301-4622

View published work (Non-McMaster Users)