Concentration-dependent conformational changes in GQ-forming ODNs

Guanine-rich oligodeoxyribonucleotides (ODNs) can form non-canonical DNA structures known as G-quadruplexes, which are four stranded structures stabilized by sodium or potassium cations. The topologies of G-quadruplexes are highly polymorphic. H-Tel, an ODN with four consecutive repeats of the human telomeric sequence, [d(AGGGTTAGGGTTAGGGTTAGGG)], can assume different monomolecular G-quadruplex topologies depending on the type of cation present …